View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12535_low_22 (Length: 227)

Name: NF12535_low_22
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12535_low_22
NF12535_low_22
[»] chr1 (2 HSPs)
chr1 (9-175)||(17056211-17056379)
chr1 (9-66)||(22596700-22596757)


Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 17056211 - 17056379
Alignment:
9 aagcaaaggtaaaaaatgctctaccctattgcaggatatggattaattggttgatatgcagtttgtgaaactc--aatttgtatatataggaatttttca 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
17056211 aagcaaaggtaaaaaatgctctaccctattgcaggatatggattaattggttgatatgcagtttgtgaaactctcaatttgtatatataggaatttttca 17056310  T
107 cagaaagaatagttgccttttttagcaatttagactattgttcacaaccagaggaaaataaatgaacat 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17056311 cagaaagaatagttgccttttttagcaatttagactattgttcacaaccagaggaaaataaatgaacat 17056379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 22596700 - 22596757
Alignment:
9 aagcaaaggtaaaaaatgctctaccctattgcaggatatggattaattggttgatatg 66  Q
    ||||| ||||| ||||||||||||||||||||||||||||||  ||||||||||||||    
22596700 aagcagaggtacaaaatgctctaccctattgcaggatatggacgaattggttgatatg 22596757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University