View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12535_low_22 (Length: 227)
Name: NF12535_low_22
Description: NF12535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12535_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 17056211 - 17056379
Alignment:
| Q |
9 |
aagcaaaggtaaaaaatgctctaccctattgcaggatatggattaattggttgatatgcagtttgtgaaactc--aatttgtatatataggaatttttca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17056211 |
aagcaaaggtaaaaaatgctctaccctattgcaggatatggattaattggttgatatgcagtttgtgaaactctcaatttgtatatataggaatttttca |
17056310 |
T |
 |
| Q |
107 |
cagaaagaatagttgccttttttagcaatttagactattgttcacaaccagaggaaaataaatgaacat |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17056311 |
cagaaagaatagttgccttttttagcaatttagactattgttcacaaccagaggaaaataaatgaacat |
17056379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 9 - 66
Target Start/End: Original strand, 22596700 - 22596757
Alignment:
| Q |
9 |
aagcaaaggtaaaaaatgctctaccctattgcaggatatggattaattggttgatatg |
66 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22596700 |
aagcagaggtacaaaatgctctaccctattgcaggatatggacgaattggttgatatg |
22596757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University