View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12536_low_10 (Length: 273)
Name: NF12536_low_10
Description: NF12536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12536_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 257
Target Start/End: Complemental strand, 40375135 - 40374882
Alignment:
| Q |
13 |
ttacatcaaatcccaatatattcatcttagggagacaacggagaaagagagaaatgccaattttgaaaattaaaactggcattgccaagctattggaacg |
112 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40375135 |
ttacatcaaattccaatatattcatcttagggagacaacggagaaagagagaaatgccaattttgaaaattaaaactggcattgccaaactattggaacg |
40375036 |
T |
|
| Q |
113 |
tagggggtcctcttcaataatttcccttattcaccagtcaattagtaaaaataaccttcatctcttaaagtgtgatggagcatgaaacaatgacattaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40375035 |
tagggggtcctcttcaataatttcccttattcgccagtcaattagtacaaataaccttcatctcttaaagtgtgatggaacatgaaacaatgacattaag |
40374936 |
T |
|
| Q |
213 |
ggcaagga---------atccaatagcagcctctctatatcctctttccaagca |
257 |
Q |
| |
|
|||||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
40374935 |
ggcaaggaacaaatcttattcaataacagcctctctatatcctctttccaagca |
40374882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University