View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12536_low_11 (Length: 273)
Name: NF12536_low_11
Description: NF12536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12536_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 256
Target Start/End: Complemental strand, 48233925 - 48233685
Alignment:
| Q |
16 |
atgaatattcatggttaaaacttttgaatgagagttttgtggaccattgcgattttatccgatttaaaatattaatctttccggtggatgattacttggt |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48233925 |
atgaacattcatggttaaaacttttgaatgagagttttgtggaccattgcgattttatctgatttaaaatattaatctttccggtggatgattacttggt |
48233826 |
T |
 |
| Q |
116 |
cacacnnnnnnntatgtgctttttaatatatttattttgcttttagcaggacttgggagcatgttttgttgattgtgaaatttttctattgatcagtcaa |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48233825 |
cacacaaaaaaatatgtgctttttaatatatttattttgcttttagcaggacttgggagcatgttttgttgattgtgaaatttttctattgatcagtcaa |
48233726 |
T |
 |
| Q |
216 |
tgaaacagttcaactatttgtggaacctaaccctacttctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48233725 |
tgaaacagttcaactatttgtggaacctaaccctacttctt |
48233685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University