View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_high_17 (Length: 338)
Name: NF12538_high_17
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 15 - 322
Target Start/End: Original strand, 5166035 - 5166342
Alignment:
| Q |
15 |
gatgaagttggaagagaggtctagggtttgaagattggtacagttggagagaaagggagatattgttccacggagagagagattgttgagcgagagtttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5166035 |
gatgaagttggaagagaggtctagggtttgaagattggtacagttggagagaaagggagagattgttccacggagagagagattgttgagcgagagtttg |
5166134 |
T |
|
| Q |
115 |
tagattctgccattgttgcagagtattcctttgagagttgaggttgattcattgcagggttttgagaaagtggcttcgttccaattttctaaggatttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5166135 |
tagattctgccattgttgcagagtattcctttgagagttgaggttgattcattgcagggttttgagaatgtggcttcgttccaattttctaaggatttgt |
5166234 |
T |
|
| Q |
215 |
ttgggtcttgtagtgatttgtttaaatgggttaaacatgcttcatcgcttggatctgatttaattgatgtgattaatgtaatccaaaacattaatactaa |
314 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5166235 |
ttgggtcttgcagtgatttgtttaaatgggttaaacatgcttcatcgcttggatctgatttaattgatgtgattaatgtaatccacaacattaatactaa |
5166334 |
T |
|
| Q |
315 |
cttcatta |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
5166335 |
cttcatta |
5166342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University