View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_high_27 (Length: 249)
Name: NF12538_high_27
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 11 - 113
Target Start/End: Complemental strand, 49199023 - 49198921
Alignment:
| Q |
11 |
cataggcaacacaagaagtttttcagtcctaaagcaatacaaagaaacttggatatcattatcattttttgtactcagaaaacataccatactttgacaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49199023 |
cataggcaacacaagaagtttttcagtcctaaagcaatacaaagaaacttggatatcattatcattttttgtactcagaaaacataccatactttgacaa |
49198924 |
T |
 |
| Q |
111 |
gtg |
113 |
Q |
| |
|
||| |
|
|
| T |
49198923 |
gtg |
49198921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University