View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_high_32 (Length: 209)
Name: NF12538_high_32
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_high_32 |
 | |
|
| [»] scaffold0543 (1 HSPs) |
| | |
|
| [»] scaffold0492 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 76 - 194
Target Start/End: Complemental strand, 34356631 - 34356513
Alignment:
| Q |
76 |
attaccgtgataaaatttacataaaatttggttttgatgtgattcttgttgttcaattttaggggaagacaaaataagtgctctacctgattcacttctt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34356631 |
attaccgtgataaaatttacataaaattcggttttgatgtgattcttgttgttcaatttcaggggaagataaaataagtgctctacctgattcacttctt |
34356532 |
T |
|
| Q |
176 |
tattatattctttcctttg |
194 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34356531 |
tattatattctttcctttg |
34356513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 96 - 193
Target Start/End: Original strand, 35047128 - 35047225
Alignment:
| Q |
96 |
ataaaatttggttttgatgtgattcttgttgttcaattttaggggaagacaaaataagtgctctacctgattcacttctttattatattctttccttt |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35047128 |
ataaaatttggttttgatgtgattctccttgttcaattccaggagaagacaaaataagtgcgctacctgattcacttctttattatattctttccttt |
35047225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 189
Target Start/End: Complemental strand, 3981 - 3919
Alignment:
| Q |
127 |
ttcaattttaggggaagacaaaataagtgctctacctgattcacttctttattatattctttc |
189 |
Q |
| |
|
||||||| ||| ||||||| ||| ||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
3981 |
ttcaattccaggagaagacagaatcagtgctctaccggattcacttctttatcacattctttc |
3919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 189
Target Start/End: Complemental strand, 5527 - 5465
Alignment:
| Q |
127 |
ttcaattttaggggaagacaaaataagtgctctacctgattcacttctttattatattctttc |
189 |
Q |
| |
|
||||||| ||| ||||||| ||| ||||||||||| ||||||||||||||| | |||||||| |
|
|
| T |
5527 |
ttcaattccaggagaagacagaatcagtgctctaccggattcacttctttatcacattctttc |
5465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University