View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_low_12 (Length: 349)
Name: NF12538_low_12
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 44552271 - 44552515
Alignment:
| Q |
15 |
atgaaacctactacattttaaattaagtatcttcttttgcagtgattaagggtgcgtttaaaaataattacaagtgataattagataatgtgacataact |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44552271 |
atgaaacctactacgttttaaattaagtatcttcttttgcagtgattaagggtgcgtttaaaaataattacaagtgatatttagataatgtgacataact |
44552370 |
T |
 |
| Q |
115 |
cgtaattctattgaccatgaacgtgacctacaaaaaccagttgtgtctttcgttatttggctagactcgcggataatatgtgtagttatgaccgctatcg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44552371 |
cgtaattctattgaccatgaacgtgacctacaaaaactagttgtgtctttcgttatttggttagactcgcggataatgtgtgtagttatgaccgctatcg |
44552470 |
T |
 |
| Q |
215 |
ggataaacttggtgccctatatttgtaattaaaatgggttggttga |
260 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44552471 |
ggat-aacttggtgccctatatttgtaattaaaatgggttggttga |
44552515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 260 - 326
Target Start/End: Original strand, 44552540 - 44552606
Alignment:
| Q |
260 |
aatggattgttagctatagtttattgatggctgcattttgtgaggaagggaggatataagattgtgg |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44552540 |
aatggattgttagctatagtttattgatggctgcattttgtgaggaagggaggatataagattgtgg |
44552606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University