View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_low_15 (Length: 339)
Name: NF12538_low_15
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 64 - 339
Target Start/End: Original strand, 3285952 - 3286227
Alignment:
| Q |
64 |
atgatcatctctttgtacatttagtggggcccctattggactccaaccattctcaacaacatgctcctctgttcctagtaccattaccatcactgttcct |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3285952 |
atgatcatctctttgtacatttagtggggcccctattggactccaaccattctcaacaacatgctcctctgttccgagtaccattaccatcactgttcct |
3286051 |
T |
 |
| Q |
164 |
ttgctcttttttcaccttttccagttttacccttcttctcttaccataataattatgattctcttcactcttcagtgttcacctttgatatcgatcacaa |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3286052 |
ttgctcttttttcaccttttccagttttacccttcttctcttaccataataattatgattctcttcactcttcagtgttcacctttgatatcaatcacaa |
3286151 |
T |
 |
| Q |
264 |
ttaacactgcaataacaccaccttcttgttcttcttcttgatcttctagttcacagaacagagcaactctgtttca |
339 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3286152 |
ttaacactgcaataataccaccttcttgttcttcttcttgatcttctagttcacagaacagagcaactctgtttca |
3286227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University