View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_low_21 (Length: 299)
Name: NF12538_low_21
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 41425823 - 41425538
Alignment:
| Q |
1 |
attcataaaatatcccaaagggtcattgtttcggaataaccccagacccaatccctatagacttcactacaagggcacatgttaggacattgcgccgtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
41425823 |
attcataaaatatcccaaagggtcattgtttcggaataatcccagacccaatccctatagacttcactacaagggcacaggttaggacgctgcgccgtca |
41425724 |
T |
|
| Q |
101 |
atggaccaaatcatatccctctagtagccaatcactgcatgatcatcgtcagacagtgatccactaa-ttgcgttgataatctctcagtaatgcaatgag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
41425723 |
atggaccaaatcatatccctctagtagccaatcactgcatgatcatcgt----cagtgatccactaatttgctttgataatctctcagtaatgcaatgag |
41425628 |
T |
|
| Q |
200 |
aaaggtagacaatcaaatataataaatccatcattctactcgacgtcacaatgtttgcagatacatcaccaactctggccgttatctctg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
41425627 |
aaaggtagacaatcaaatataataaatccatcattctactcgacgtcacaatgtttgcagatgcatcaccaactccgaccgttatctctg |
41425538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University