View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_low_27 (Length: 250)
Name: NF12538_low_27
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 21114094 - 21113859
Alignment:
| Q |
1 |
acattgacattaattgcaaacatttttgtacgaaatcatattctgacattcaaacattccactgcatgcattcatgcacttagaagagtttgatcaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21114094 |
acattgacattaattgcaaacatttttgtacgaaatcatattctgacattcaaacattcgactgcatgcattcatgcacttagaacagtttgatcaagat |
21113995 |
T |
 |
| Q |
101 |
tgacaaatcaaattttaagtttggaaatttggttatnnnnnnnctcgaagtttcagttttagtttatggaactaaatcgacacaattgcagtgtagttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
21113994 |
tgacaaatcaaattttaagtttggaaatttggttataaaaaaactcgaagtttcaattttagtttatggaactaaatcaacagaattgcagtgtagttgc |
21113895 |
T |
 |
| Q |
201 |
gaatcacgcgataaaaacacacatacacattgcaac |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21113894 |
gaatcacgcgagaaaaacacacatacacattgcaac |
21113859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University