View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_low_38 (Length: 206)
Name: NF12538_low_38
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 84 - 187
Target Start/End: Complemental strand, 4516929 - 4516826
Alignment:
| Q |
84 |
ccatctccattgcattaacattggaagaaaaatatgattgtgttgttcctaacatcatttgagaagaatttccagttgataaagacaacattggtggtaa |
183 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4516929 |
ccatctccattgcattaacatttgaagaaaaatatgattgtgttgttcctaacatcatttgagaagaatttccagttgataaagacaacattggtggcaa |
4516830 |
T |
 |
| Q |
184 |
agat |
187 |
Q |
| |
|
|||| |
|
|
| T |
4516829 |
agat |
4516826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University