View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12538_low_9 (Length: 386)
Name: NF12538_low_9
Description: NF12538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12538_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 342; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 18 - 375
Target Start/End: Original strand, 7885906 - 7886263
Alignment:
| Q |
18 |
gaatacgaccccaagcactctggtgtggcctcgaagcaaagttgggagattgaccagcaattcaataacaaaagttagcaccgtaacattagatatttct |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7885906 |
gaatacgtccccaagcactctggtgtggcctcgaagcaaagttgggagattgaccagcagttcaataacaaaagttagcaccgtaacattagatatttct |
7886005 |
T |
|
| Q |
118 |
ctacttgatctttcttttcgttttatagatagatcttagtccttacctggcgcatgcaccaaccaaacacccttgaggtctacttttttgcgtgtttatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7886006 |
ctacttgatctttcttttcgttttatagatagatcttagtccttacctggcgcatgcaccaaccaaacacccttgaggtctacttttttgcgtgtttatt |
7886105 |
T |
|
| Q |
218 |
aaatttcgacttcaacgttggaattgcattaattgtaattttgtctacaccaaaatcatataatcttacctgttggaagtatttgccaagacgttacagc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7886106 |
aaatttcgacttcaacgttggaattgcattaattgtaattttgtttacaccaaaatcatataatcttacctgttggaagtatttgctaagacgttacagc |
7886205 |
T |
|
| Q |
318 |
gcaaacttcctgctgaatctccaacatgggtaaggaacttttggatgtcaatgttctt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7886206 |
gcaaacttcctgctgaatctccaacatgggtaaggaacttttggatgtcaatgttctt |
7886263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 7913178 - 7913282
Alignment:
| Q |
18 |
gaatacgaccccaagcactctggtgtggcctcgaagcaaagttgggagattgaccagcaattcaataacaaaagttagcaccgtaacattagatatttct |
117 |
Q |
| |
|
||||||| ||||||| ||| |||| ||||| |||||| ||||||| ||||||||||||| ||||| ||| | ||||||| |||||||| ||||||||| |
|
|
| T |
7913178 |
gaatacgtccccaaggactgtggtatggccccgaagcgaagttggcagattgaccagcagttcaaaaac---atttagcactgtaacattggatatttct |
7913274 |
T |
|
| Q |
118 |
ctacttga |
125 |
Q |
| |
|
||| |||| |
|
|
| T |
7913275 |
ctatttga |
7913282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University