View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12539_low_11 (Length: 246)
Name: NF12539_low_11
Description: NF12539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12539_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 35583643 - 35583757
Alignment:
| Q |
1 |
tgtggcggtggtgggcaactgcgttgagttggggtgtgacttcagcctgtttctgctaaagcggcagccgcttcatttcgtttttgtaaatggaacgcaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35583643 |
tgtggcggaggtgggcaactgcgttgagttggggtgcgacttcagcctgtttctgctaaagcggcagccgcttcatttcatttttgtaaatggaacgcaa |
35583742 |
T |
|
| Q |
101 |
ctgctcagtttttgt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35583743 |
ctgctcagtttttgt |
35583757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 119 - 234
Target Start/End: Original strand, 35583809 - 35583924
Alignment:
| Q |
119 |
tgggctttttgtttcttttgaatttaaacatgtttgtaagtgagtgattagtctcacatcgactatgaatgagtcaaatgttcaagtgcaaataattaat |
218 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35583809 |
tgggctttttgtttctcttgaattcaaacatgtttgtaagtgactgattagtctcacatcaattatgaatgagtcaagtgttcaagtgcaaataattaat |
35583908 |
T |
|
| Q |
219 |
ccgtcttttgatgtcc |
234 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
35583909 |
ccctcttttgatgtcc |
35583924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University