View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12539_low_13 (Length: 243)
Name: NF12539_low_13
Description: NF12539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12539_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 143 - 226
Target Start/End: Original strand, 32684912 - 32684995
Alignment:
| Q |
143 |
ctcctcctcattgtcataactacagttataatatctatgattcgacgggtatcgaatcatcgacactacagatccttctctctc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684912 |
ctcctcctcattgtcataactacagttataatatctatgattcgacgggtatcgaatcatcgacactacagatccttctctctc |
32684995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 62
Target Start/End: Original strand, 32684782 - 32684831
Alignment:
| Q |
13 |
gttcactgttttcatcacaaacttgagcatccccgtaattctccaaactt |
62 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
32684782 |
gttcactgttttcatcacaaacttcagcatcccagtaattctccaaactt |
32684831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University