View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12539_low_8 (Length: 276)
Name: NF12539_low_8
Description: NF12539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12539_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 20 - 276
Target Start/End: Complemental strand, 6968228 - 6967972
Alignment:
| Q |
20 |
agacggatgttcaaatatcacatgactccacttacctcccctttcatattcaccattacctgtgcaatttgtgtaaagctttctctgcctcttacttaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968228 |
agacggatgttcaaatatcacatgactccacttacctcccctttcatattcaccattacctgtgcaatttgtgtaaagctttctctgcctcttacttaga |
6968129 |
T |
 |
| Q |
120 |
ccaatttctttaccttgttccaaaacatggttaaggtaagatttctcaacgaaatcgcgatgactacgatgaaatgtgagaaggtagaatcttttgtctg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968128 |
ccaatttctttaccttgttccaaaacatggttaaggtaagatttctcaacgaaatcgcgatgactacgatgaaatgtgagaaggtagaatcttttgtctg |
6968029 |
T |
 |
| Q |
220 |
aagctggatagaatgaaacagaatttgtgttggggacaatcttgattagactccaaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6968028 |
aagctggatagaatgaaacagaatttgtgttggggacaatcttgattagactccaaa |
6967972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University