View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1254-Insertion-2 (Length: 157)

Name: NF1254-Insertion-2
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1254-Insertion-2
NF1254-Insertion-2
[»] chr1 (3 HSPs)
chr1 (8-82)||(37616193-37616267)
chr1 (84-154)||(37616319-37616389)
chr1 (47-78)||(37629843-37629874)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 7e-35; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 7e-35
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 37616193 - 37616267
Alignment:
8 catagaaagttatagggagataaaagcagatattcacaggatccaaatagtatggatgaaataaaggaatgctat 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37616193 catagaaagttatagggagataaaagcagatattcacaggatccaaatagtatggatgaaataaaggaatgctat 37616267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 6e-23
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 37616319 - 37616389
Alignment:
84 ttttgcaaaatcacaatggatcgcggtgattctgatatactcaccgtgatacgaaacgtacattaaatatt 154  Q
    ||||||||||| || ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
37616319 ttttgcaaaattacgatggatcgcggtgattctgatatactcaccgtgatattaaacgtacattaaatatt 37616389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 47 - 78
Target Start/End: Original strand, 37629843 - 37629874
Alignment:
47 gatccaaatagtatggatgaaataaaggaatg 78  Q
    |||||||||||||||||||||||||| |||||    
37629843 gatccaaatagtatggatgaaataaaagaatg 37629874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University