View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1254-Insertion-6 (Length: 303)
Name: NF1254-Insertion-6
Description: NF1254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1254-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 8 - 303
Target Start/End: Original strand, 37460525 - 37460816
Alignment:
| Q |
8 |
atagcatctcatcaaaagatcagttactgaataatccatctaaggtttgcatcttacaatgtcattcttaaaggnnnnnnnnnnnnnngttttatatagt |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37460525 |
atagcatctcatcacaagatcagttactgaatagtccatctaaggtttgcatcttacaatgtcattcttaaaggaaaaaaaaaaa---gttttatatagt |
37460621 |
T |
|
| Q |
108 |
tgcaatgaggtccataaactcatgaaatttagattcatgtaccgtatttgttgaacaaaggattagtattgcgaaaaactatagacaaatgcagttgatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37460622 |
tgcaatgaggtccataaactcatgaaatttagattcatgtacca-atttgttgaacaaaggattagtattgcgaaaaattatagacaaatgcagttgatg |
37460720 |
T |
|
| Q |
208 |
cagtctcagaggtctcaaaattgatgatcttatggtcacaaatgagattgcgaacggcaatttaaaacgttgttttacccccattttttagctcag |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37460721 |
cagtctcagaggtctcaaaattgacgatcttatggtcacaaatgagattgcgaacggcaatttaaaacgttgttttacccccattttttagctcag |
37460816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University