View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12540_high_7 (Length: 275)
Name: NF12540_high_7
Description: NF12540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12540_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 4749443 - 4749182
Alignment:
| Q |
1 |
acttctcaccctcgtcgtctctggcttccatcaacaactccatcaaatcnnnnnnngtctgttgtttttcattattattgtttctcctcttatgatccac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749443 |
acttctcaccctcgtcgtctctggcttccatcaacaactccatcaaatctttttttgtctgttgtttttcattattattgtttctcctcttatgatccac |
4749344 |
T |
 |
| Q |
101 |
caagcctttcaacagcttcaccaacttctttcgtgcctaaacacaataggannnnnnnaaatgtaactataaggtgtgaatcaaattgtgtacttagatg |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4749343 |
caaacctttcaacagcttcaccaacttctttcgtgcctaaacacaataggatttttttaaatgtaactataaggtgtaaatcaaattgtgtacttagatg |
4749244 |
T |
 |
| Q |
201 |
aataaatgagtatataat---ttaccttgagtgctttatagaatggaaagccaggaagattg |
259 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749243 |
aataaatgagtatataattaattaccttgagtgctttatagaatggaaagccaggaagattg |
4749182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 145
Target Start/End: Complemental strand, 4757856 - 4757783
Alignment:
| Q |
72 |
ttattattgtttctcctcttatgatccaccaagcctttcaacagcttcaccaacttctttcgtgcctaaacaca |
145 |
Q |
| |
|
|||||||| || ||||| || |||||||||||| ||| ||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
4757856 |
ttattattattcctccttttttgatccaccaaggcttgcaatagcttcatcaacttctttcttgcctaaacaca |
4757783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University