View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12540_high_8 (Length: 257)
Name: NF12540_high_8
Description: NF12540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12540_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 158 - 242
Target Start/End: Original strand, 34899812 - 34899896
Alignment:
| Q |
158 |
gtctaaaggggttccctagagaggtggaagtacgtaggattgatgaccgggaagtaaggcatggcatactgcatgcttatggaca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899812 |
gtctaaaggggttccctagagaggtggaagtacgtaggattgatgaccgggaagtaaggcatggcatactgcatgcttatggaca |
34899896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 34899663 - 34899696
Alignment:
| Q |
7 |
tcatcgtcgtcaatatttcgatcatccatgatag |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34899663 |
tcatcgtcgtcaatatttcgatcatccatgatag |
34899696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University