View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12540_high_8 (Length: 257)

Name: NF12540_high_8
Description: NF12540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12540_high_8
NF12540_high_8
[»] chr6 (2 HSPs)
chr6 (158-242)||(34899812-34899896)
chr6 (7-40)||(34899663-34899696)


Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 158 - 242
Target Start/End: Original strand, 34899812 - 34899896
Alignment:
158 gtctaaaggggttccctagagaggtggaagtacgtaggattgatgaccgggaagtaaggcatggcatactgcatgcttatggaca 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34899812 gtctaaaggggttccctagagaggtggaagtacgtaggattgatgaccgggaagtaaggcatggcatactgcatgcttatggaca 34899896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 40
Target Start/End: Original strand, 34899663 - 34899696
Alignment:
7 tcatcgtcgtcaatatttcgatcatccatgatag 40  Q
    ||||||||||||||||||||||||||||||||||    
34899663 tcatcgtcgtcaatatttcgatcatccatgatag 34899696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University