View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12540_low_17 (Length: 255)
Name: NF12540_low_17
Description: NF12540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12540_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 9496613 - 9496855
Alignment:
| Q |
1 |
tccaactgttaggtctggtagttccagcccaagacactggggaatgagaggctggtatcatgatggaagtaatttagaggatggttgtttaagaatggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496613 |
tccaactgttaggtctggtagttccagcccaagacactggggaatgagaggctggtatcatgatggaagtaatttagaggatggttgtttaagaatggat |
9496712 |
T |
|
| Q |
101 |
ggtgctgaagttgtgtggccttcttggagaggtaaaaacattgcagtacagcctctgatccaacctttacctgctgccttgctgcaggaccgcctgattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496713 |
ggtgctgaagttgtgtggccttcttggagaggtaaaaacattgcagtacagcctctgattcaacctttacctgctgccttgctgcaggaccgcctgattg |
9496812 |
T |
|
| Q |
201 |
caatgtcacagatagcacgtgaccaggaacatgtaagagagat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9496813 |
caatgtcacagatagcacgtgaccaggaacatgtaagaaagat |
9496855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University