View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12540_low_21 (Length: 242)
Name: NF12540_low_21
Description: NF12540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12540_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 30360827 - 30361039
Alignment:
| Q |
17 |
ctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaaagnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30360827 |
ctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaatgaa |
30360926 |
T |
|
| Q |
117 |
nnnnnngtcctggttgttaaaatttctttggaagaaaatacgcatgcttnnnnnnngtcttgattgctcactcttttaatactggttgcgccttaaattt |
216 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360927 |
aaaaaagtcctggttgtttaaatttcttttgaagaaaatacgcatgcttaaaaaaagtcttgattgctcactcttttaatactggttgcgccttaaattt |
30361026 |
T |
|
| Q |
217 |
tctcatctgtgct |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30361027 |
tctcatctgtgct |
30361039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 17 - 112
Target Start/End: Original strand, 19916226 - 19916321
Alignment:
| Q |
17 |
ctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19916226 |
ctggaactgggattgggtccctgcaaggtacattcatatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaa |
19916321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University