View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12540_low_22 (Length: 241)
Name: NF12540_low_22
Description: NF12540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12540_low_22 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 41130354 - 41130576
Alignment:
| Q |
19 |
ttatcaccacaattacaatcacaaaattttatttagaataggcttgggctacggtttatgatccacaacaaactgggcagggtttaaaaatggaaaaacg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130354 |
ttatcaccacaattacaatcacaaaattttatttagaataggcttgggctacggtttatgatccacaacaaactgggcagggtttaaaaatggaaaaacg |
41130453 |
T |
|
| Q |
119 |
tgacttacatttggaggacaaaagagtagagacacaaatttaagggaactaacaacaacttttgtttttctatacataggttcataataaaacacaaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41130454 |
tgacttacatttggaggacaaaagagtagagacacaaatttaagggaactaacaacaacttttgtttttctatacataggttcataataaaacacaaaat |
41130553 |
T |
|
| Q |
219 |
ttggccaagttgcgaccccatct |
241 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
41130554 |
ttggccaaggtgcgaccccatct |
41130576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University