View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12541_high_3 (Length: 278)
Name: NF12541_high_3
Description: NF12541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12541_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 17 - 178
Target Start/End: Complemental strand, 54080781 - 54080620
Alignment:
| Q |
17 |
aaaacttgtggttgaagccccttgaacatgcacattcgcatgatttatgacatgttccaatacaatatgtcgactcatatgatggccactaaccatagtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080781 |
aaaacttgtggttgaagccccttgaacatgcacattcgcatgatttatgacatgttccaatacaatatgtcgactcatatgatggccactaaccatagtg |
54080682 |
T |
 |
| Q |
117 |
gaggatgaaaggctgtttattattgactatatgcatgataatatgacatggtgtttttgctc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080681 |
gaggatgaaaggctgtttattattgactatatgcatgataatatgacatggtgtttttgctc |
54080620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 17 - 146
Target Start/End: Complemental strand, 54084136 - 54084009
Alignment:
| Q |
17 |
aaaacttgtggttgaagccccttgaacatgcacattcgcatgatttatgacatgttccaatacaatatgtcgactcatatgatggccactaaccatagtg |
116 |
Q |
| |
|
|||||||||||||||| | |||||||| ||| |||| |||||||||||| ||||| |||||||| ||| ||||||||| |||||||||| | ||||| |
|
|
| T |
54084136 |
aaaacttgtggttgaaacgccttgaacttgctcattggcatgatttatggcatgtgccaataca--atgccgactcatacgatggccactctacttagtg |
54084039 |
T |
 |
| Q |
117 |
gaggatgaaaggctgtttattattgactat |
146 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |
|
|
| T |
54084038 |
gaggatgaaaggttgtttattgttgactat |
54084009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 211 - 272
Target Start/End: Complemental strand, 54080584 - 54080523
Alignment:
| Q |
211 |
ctgatcctttgcgtgaacagctcatctcatggttataggtgaggtagggattttgtctgtgc |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080584 |
ctgatcctttgcgtggacagctcatctcatggttataggtgaggtagggattttgtctgtgc |
54080523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University