View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12541_high_7 (Length: 255)
Name: NF12541_high_7
Description: NF12541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12541_high_7 |
 |  |
|
| [»] scaffold0329 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 237
Target Start/End: Complemental strand, 35150318 - 35150090
Alignment:
| Q |
12 |
agcacagaacaaattaaagaataatagtcagataatattttgaatgatattatgtccatctacaaccttacaaaggcattgtttgatgttaggacccaca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35150318 |
agcatagaacaaattaaagaataatagtcagataatattttgaatgatattatgtccatctacaaccttacaaaggcattttttgatgttaggacccaca |
35150219 |
T |
 |
| Q |
112 |
tttttgtctt---ctcaaaattatatcctccataactcataccatcttgtctataaccatccaacacaccatcaactaacttgatgaagccttatgtttc |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35150218 |
tttttgtcttctcctcaaaattatatcctccataactcataccatcttgtctataaccctccaacacaccatcaactaatttgatgaagccttatgtttc |
35150119 |
T |
 |
| Q |
209 |
tctccatttagccaaacaaccgaaaatgt |
237 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
35150118 |
tctccatttagccaaacaactgaaaatgt |
35150090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 35128080 - 35128044
Alignment:
| Q |
155 |
ttgtctataaccatccaacacaccatcaactaacttg |
191 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
35128080 |
ttgtctataaccatccaacacgccattaactaacttg |
35128044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0329 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0329
Description:
Target: scaffold0329; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 64 - 121
Target Start/End: Complemental strand, 17081 - 17024
Alignment:
| Q |
64 |
tgtccatctacaaccttacaaaggcattgtttgatgttaggacccacatttttgtctt |
121 |
Q |
| |
|
|||||||| |||| ||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
17081 |
tgtccatcaacaatcttacgaaggcattgtttaatgttaggacccatctttttgtctt |
17024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 64 - 121
Target Start/End: Original strand, 19283585 - 19283642
Alignment:
| Q |
64 |
tgtccatctacaaccttacaaaggcattgtttgatgttaggacccacatttttgtctt |
121 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||| |||||||||| |||||||||| |
|
|
| T |
19283585 |
tgtccatcaacaaccttacgaagacattgtttgatattaggacccatctttttgtctt |
19283642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University