View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12541_low_11 (Length: 256)
Name: NF12541_low_11
Description: NF12541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12541_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 256
Target Start/End: Original strand, 14732852 - 14733100
Alignment:
| Q |
8 |
gaggagcagagagaccagaattggaggaaatagcctaaggaatagtttttgttttgatgatataagaaagagtcatggcttaagaagacaaagtacacaa |
107 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14732852 |
gaggaacagaaagaccagaattggaggaaatagcctaaggaatggtttttgttttgatgatataagaaagagtcatggcttaagaagacaaagtacacaa |
14732951 |
T |
 |
| Q |
108 |
aaagttttggcccgtgaagtttgcatgtgatcattaagagctgttataatcagtgcccttgcacattatagacccactcacgtgtatcatcatttgtctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14732952 |
aaagttttggcccgtgaagtttgcatgtgatcattaagagctgttataatcagtgcccttgcacattatagacccactcacgtgtatcatcatttgtctt |
14733051 |
T |
 |
| Q |
208 |
ttgcatcaaatcttcattcattattatattattgctaatacaaattcat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14733052 |
ttgcatcaaatcttcattcattattatattattgctaatacaaattcat |
14733100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University