View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12542_high_4 (Length: 488)
Name: NF12542_high_4
Description: NF12542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12542_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 238 - 478
Target Start/End: Original strand, 38325284 - 38325524
Alignment:
| Q |
238 |
gcaaattctaattggctaggtttaagaacaatgacggtaaccaatacaatatacttcaaagtaatcaatgactaaaacaaatacaaatttaagaaaattc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38325284 |
gcaaattctaattggctaggtttaagaacaatgactgtaaccaatacaatatacttcaaagtaatcaatgactaaaacaaatacagatttaagaaaattc |
38325383 |
T |
 |
| Q |
338 |
aatgaataagtagctatagtatcctctgttgctctcttcctatgtgattgagttttatttctatccaagttattttcatacaattatgtttgaattcact |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38325384 |
aatgaataagtagctatagtatcctctgttgctctcttcctatgtgattgagttttatttcaatcgaagttattttcatacaattatgtttgaattcact |
38325483 |
T |
 |
| Q |
438 |
aggttaaactgtattcaattttttggcatgtaatccctttg |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38325484 |
aggttaaactgtattcaattttttggcatgtaatccctttg |
38325524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 18 - 177
Target Start/End: Original strand, 38324320 - 38324479
Alignment:
| Q |
18 |
ccaacattgttggacacgccttcagtttaaaatatcggtgttacaagtgttaagaagtgcactcaaatgcagccttggctcccctctgagagagggaaac |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324320 |
ccaacattgttggacacaccttcagtttaaaatatcggtgttacaagtgtaaataagtgcactcaaatgcagccttggctcccctctgagagagggaaac |
38324419 |
T |
 |
| Q |
118 |
tttgcaggcatcagattaatcacacacttcttctgtatcaatgtaagtttctttgctgcc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324420 |
tttgcaggcatcagattaatcacacacttcttctgtatcaatgtaagtttctttgctgcc |
38324479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University