View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12542_low_14 (Length: 304)
Name: NF12542_low_14
Description: NF12542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12542_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 37 - 184
Target Start/End: Complemental strand, 24993075 - 24992928
Alignment:
| Q |
37 |
ttgagatatgtaactctgcaatggtgtatttcactaatgaaaggaaattcatggtgtgaaaatattcatacccggaagcttcatggccaaaaatccgagg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24993075 |
ttgagatatgtaactctgcaatggtgtatttcaccaatgaaaggaaattcatggtgtgaaaatattcatacccggaagcttcatggccaaaaatccgagg |
24992976 |
T |
 |
| Q |
137 |
aaaagcacgttgaggttcagactttgattgacgaaaaaagatgaagaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24992975 |
aaaagcacgttgaggttcagactttgattgacgaaaaacgatgaagaa |
24992928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 101 - 167
Target Start/End: Complemental strand, 24984840 - 24984774
Alignment:
| Q |
101 |
ttcatacccggaagcttcatggccaaaaatccgaggaaaagcacgttgaggttcagactttgattga |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
24984840 |
ttcatacccggaagcttcatggccaaaaatccgaggataagcacgttgaggctcacactttgattga |
24984774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 287
Target Start/End: Complemental strand, 24992914 - 24992854
Alignment:
| Q |
230 |
ttgcatataaatgtagata---atagatgtgtaattgtgcttacctctcctttccaaccac |
287 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24992914 |
ttgcatataaatgtagatataaataaatgtgtaattgtgattacctcgcctttccaaccac |
24992854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University