View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12542_low_17 (Length: 264)
Name: NF12542_low_17
Description: NF12542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12542_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 27986416 - 27986651
Alignment:
| Q |
18 |
ggaatatcgtctacaacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgtagaatatattgcgccg |
117 |
Q |
| |
|
|||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27986416 |
ggaagatcgtcgataacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgtagaatatatcgcgccg |
27986515 |
T |
|
| Q |
118 |
cgatttctgcggcggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattgtgagaggtattaggttcgggattaggctcaggttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27986516 |
cgatttctgcggcggttggtggtggtttgtttgtggtggtttgtggaggagaagatggagcattgtgagaggtattagattcgggattaggctcaggttc |
27986615 |
T |
|
| Q |
218 |
gggaatgggattgggattaggttcggagtgaacgag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27986616 |
gggaatgggattgggattaggttcggagtgaacgag |
27986651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 28043718 - 28043953
Alignment:
| Q |
18 |
ggaatatcgtctacaacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgtagaatatattgcgccg |
117 |
Q |
| |
|
|||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28043718 |
ggaagatcgtcgataacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgtagaatatatcgcgccg |
28043817 |
T |
|
| Q |
118 |
cgatttctgcggcggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattgtgagaggtattaggttcgggattaggctcaggttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28043818 |
cgatttctgcggcggttggtggtggtttgtttgtggtggtttgtggaggagaagatggagcattgtgagaggtattagattcgggattaggctcaggttc |
28043917 |
T |
|
| Q |
218 |
gggaatgggattgggattaggttcggagtgaacgag |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28043918 |
gggaatgggattgggattaggttcggagtgaacgag |
28043953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 130 - 182
Target Start/End: Original strand, 27241251 - 27241303
Alignment:
| Q |
130 |
cggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
27241251 |
cggttggtggtggtttgtttgaggtggtttgtggatgagaaggtggagcattg |
27241303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 130 - 182
Target Start/End: Original strand, 27247124 - 27247176
Alignment:
| Q |
130 |
cggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
27247124 |
cggttggtggtggtttgtttgaggtggtttgtggatgagaaggtggagcattg |
27247176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 242
Target Start/End: Original strand, 27241303 - 27241345
Alignment:
| Q |
200 |
gggattaggctcaggttcgggaatgggattgggattaggttcg |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27241303 |
gggattaggctcagtttcgggaatgggattgggattaggttcg |
27241345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 242
Target Start/End: Original strand, 27247176 - 27247218
Alignment:
| Q |
200 |
gggattaggctcaggttcgggaatgggattgggattaggttcg |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27247176 |
gggattaggctcagtttcgggaatgggattgggattaggttcg |
27247218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University