View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12542_low_19 (Length: 246)
Name: NF12542_low_19
Description: NF12542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12542_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 18725621 - 18725412
Alignment:
| Q |
18 |
cactgaactcaccatggaatcctctaaagcaaattccatatctcattttatgttcagccacaaataccgcatcgtcaacattacattttatacactcctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18725621 |
cactgaactcaccatggaatcctctaaagcaaattccatatctcattttatgttcagccacaaataccgcatcgtcaacattacattttatatactcctc |
18725522 |
T |
 |
| Q |
118 |
acttggcttcatccaacataatggagatcttgtatcatttatgctttctacttgctgcaattttgtattcctgcatgcccaccggaccggaactctgcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18725521 |
acttggcttcatccaacataatggagatcttgtatcatttatgctttctacttgctgcaattttgtattcctgcatgcccaccggaccggaactctgcta |
18725422 |
T |
 |
| Q |
218 |
atgcgtctct |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
18725421 |
atgcgtctct |
18725412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University