View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12542_low_21 (Length: 238)
Name: NF12542_low_21
Description: NF12542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12542_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 13136592 - 13136385
Alignment:
| Q |
16 |
aatgattacggagaaatgaatgaaaaatttagttatgctatatatatttatattagaatagtgtagttgcggcttattctctcttttagaatattatcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13136592 |
aatgattacggagaaatgaatgaaaaatttagttatgctatata-atttatattagaatagtgtagttgcagcttattctctcttttagaatattatcac |
13136494 |
T |
|
| Q |
116 |
tctcatttatgaaaaaaccaaaatcac-tttatgtacttaaannnnnnnatgtctccatattcatcatgtgcacttgtattattaatgatttgtttataa |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13136493 |
tctcatttatgaaaaaaccaaaatcacttttatgtacttaaatttttttatgtctctatattcatcatgtgcacttgtactattaatgatttgtttataa |
13136394 |
T |
|
| Q |
215 |
catcttcat |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
13136393 |
catcttcat |
13136385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 87 - 138
Target Start/End: Complemental strand, 45134677 - 45134626
Alignment:
| Q |
87 |
gcttattctctcttttagaatattatcactctcatttatgaaaaaaccaaaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| || || |||||| |
|
|
| T |
45134677 |
gcttattctctcttttagaatattatctctctcatttataaacaacccaaaa |
45134626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 87 - 128
Target Start/End: Original strand, 11927118 - 11927159
Alignment:
| Q |
87 |
gcttattctctcttttagaatattatcactctcatttatgaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
11927118 |
gcttattctctcttttagaatattatctctttcatttatgaa |
11927159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 128
Target Start/End: Complemental strand, 3905235 - 3905202
Alignment:
| Q |
95 |
tctcttttagaatattatcactctcatttatgaa |
128 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
3905235 |
tctcttttagaatattatctctctcatttatgaa |
3905202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University