View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12542_low_9 (Length: 393)
Name: NF12542_low_9
Description: NF12542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12542_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 18 - 381
Target Start/End: Original strand, 14250973 - 14251334
Alignment:
| Q |
18 |
tcttcttactaattttgctcttgtacttatgccgatgcctttgtacttttgctagatgtcaatttatctctattgttgaaattgtttgatacattttaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14250973 |
tcttcttactaattttgctcttgtacttatgccgatgccgttgtacttttgctagatgtcaatttatctct--tgttgaaattgtttgatacattttaaa |
14251070 |
T |
|
| Q |
118 |
tggcgatcatgtttgattagatttattgtgttttcttacatatgcagcttgtatatgataaggatacattttcaactgatgattttatgggcgaagctga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14251071 |
tggcgatcatgtttgattagatttattgtgttttcttacatatgcagcttgtatatgataaggatacattttcaactgatgattttatgggcgaagctga |
14251170 |
T |
|
| Q |
218 |
aatagacattcaaccactagttttagctgcaattgcatacgagaaatctacggccaacgagtccgtgcagctagagaaatttgtagcaagcagtgacaac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
14251171 |
aatagacattcaaccactagttttagctgcaattgcatacgagaaatctacggccaacgagtccgtgcagctagagaaatttgtagaaagcagggacaac |
14251270 |
T |
|
| Q |
318 |
actcttgttagagatggtgtcatatctcttgaggatgggaagatcaaacaagaaatctcagtga |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14251271 |
actcttgttagagatggtgtcatatctcttgaggatgggaagatcaaacaagaaatctcagtga |
14251334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 198 - 265
Target Start/End: Complemental strand, 4987656 - 4987589
Alignment:
| Q |
198 |
gattttatgggcgaagctgaaatagacattcaaccactagttttagctgcaattgcatacgagaaatc |
265 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| |||| | ||| |||| ||||| |||||||| |
|
|
| T |
4987656 |
gattttatgggagaggctgaaatagacattcaaccattagtatcagcagcaaaagcatatgagaaatc |
4987589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University