View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12543_low_1 (Length: 295)
Name: NF12543_low_1
Description: NF12543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12543_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 52850848 - 52850575
Alignment:
| Q |
1 |
caataacccgcttcaggtatagttcctctcttcccttcctcgaaaacttcttatgcacttgcttactgagcattttcctctcacgggttagagacagcag |
100 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850848 |
caataccccacttcaggtatagttcctctcttcccttcctcgaaaacttcttatgcacttgcttactgagcattttcctctcacgggttagagacagcag |
52850749 |
T |
 |
| Q |
101 |
gctgttcagtaattgtggcatgaaaatagtgtgaaaacttgatatatgacataaaaatagcatataattgtgactttatgcaagtgtttgatgtaaagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52850748 |
gctgttcagtaattgtggcatgaaaatagtgtgaaaacttgatatatgacataaaaatagcatataattgtgactttatgcaagtgtttgatgtaaagca |
52850649 |
T |
 |
| Q |
201 |
ttcaaagtgaaacaccagccattatgtttcatctcatgggatgatcacatgcttcatattttcagtgaaacatc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850648 |
ttcaaagtgaaacaccagccattatgtttcatctcatgggatgatcacatgcttcatattttcagtgaaacatc |
52850575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University