View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_18 (Length: 371)
Name: NF12545_high_18
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 19 - 362
Target Start/End: Original strand, 52609535 - 52609878
Alignment:
| Q |
19 |
atgagtacaatgtgattagaatgaggatgtctcaatgatgctaagggacatgtcttttcatttcaaaatagccttagatttcatgcataatgactgtgtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609535 |
atgagtacaatgtgattagaatgaggaggtctcaatgatgctaagggacatgtcttttcatttcaaaatagccttagatttcatgcataatgactgtgtc |
52609634 |
T |
|
| Q |
119 |
ggttaattatgttttttgagttgtcgctttgtatcgcgcgtgaggacactcgtcaaaggatgtttgatgaaggtgtgatatttgcgagtgcgtttgtttg |
218 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52609635 |
ggctaattatgttttttgagttgtcgctttgtatcgcccgtgaggacactcgtcaaaggatgtttgatgaaggtgtgatatttgcgagtgcgtttgtttg |
52609734 |
T |
|
| Q |
219 |
tggcaaaggttgggattattgaattttatgttaatatgtaatttgtcgatttaaggagaatgaatcacatttttcagatttattgtatattgtatataag |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52609735 |
tggcaaaggttgggattattgaattttatgtcaatatgtaatttgtcgatttaaggagaatgaatcacattttccagatttattgtatattgtatataag |
52609834 |
T |
|
| Q |
319 |
tgtggatcttgccttctaagtgaatttttgtttttctttcttct |
362 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52609835 |
tgtggatcttgccttctaagtgagtttttgtttttctttcttct |
52609878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University