View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_2 (Length: 787)
Name: NF12545_high_2
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_2 |
 |  |
|
| [»] scaffold0066 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0066 (Bit Score: 176; Significance: 2e-94; HSPs: 4)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 176; E-Value: 2e-94
Query Start/End: Original strand, 407 - 590
Target Start/End: Complemental strand, 32800 - 32617
Alignment:
| Q |
407 |
atttttatcatttcactcatgtcacttctggacagagcttattggcggttagtactacaaagtatgtttgcagtgtttattaaataattccggcattgcc |
506 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32800 |
atttttatcatttcactcatttcacttctggacagagcttattggcggttagtactacaaagtatgtttgcagtgtttattaaataattcaggcattgcc |
32701 |
T |
 |
| Q |
507 |
tctagttatttctgtccaagaacaaactacattcaaacaataaaatttgaaagtaccatcaattcgtggtagtgcaatggctcc |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32700 |
tctagttatttctgtccaagaacaaactacattcaaacaataaaatttgaaagtaccatcaattcgtggtagtgcaatggctcc |
32617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 113; E-Value: 8e-57
Query Start/End: Original strand, 653 - 785
Target Start/End: Complemental strand, 32554 - 32422
Alignment:
| Q |
653 |
gttcgattactatatatgaaacttcatttcctctttattattagccaatttttcattcatgtttatacaaaaaacgcttaaacttgaaacccaagtttac |
752 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32554 |
gttcgattactatatatgaaacttcatttcctctttattattagccaatttttcattcatgttaatacaaaaaacgcttaaacttgaaacccaagtttac |
32455 |
T |
 |
| Q |
753 |
ttgtatcttatggatgtccatctcattggattg |
785 |
Q |
| |
|
||||||||||||| |||| |||| |||| |||| |
|
|
| T |
32454 |
ttgtatcttatggctgtctatctaattgcattg |
32422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #3
Raw Score: 101; E-Value: 1e-49
Query Start/End: Original strand, 92 - 223
Target Start/End: Complemental strand, 33108 - 32979
Alignment:
| Q |
92 |
tatcaccatctcctatcagaagatgcagaagcaggactaagattttcttcttttgggatgaaagatgaaaaaccgattgaaaatctgatcttatacgcgc |
191 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33108 |
tatcaccatctcctatcagaaaatgcagaagcaggactaaggtttt--tcttttgggatgaaagatgaaaaactgattgaaaatctgatcttatacgcgc |
33011 |
T |
 |
| Q |
192 |
ccgcctccttcgttttgtcttcaaccagcgta |
223 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
33010 |
cttcctccttcgttttgtcttcaaccagcgta |
32979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #4
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 273 - 333
Target Start/End: Complemental strand, 32934 - 32874
Alignment:
| Q |
273 |
gttagtcacggttaaaataaaagtgtggcaattatagcttaccttatctttctatccaaac |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32934 |
gttagtcacggttaaaataaaagtgtggcaattatagcttaccttatctttctatccaaac |
32874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 23290049 - 23290000
Alignment:
| Q |
42 |
acgtgtctgataccgcaacacgtctaatccaaggaatgtccgtgcttcat |
91 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
23290049 |
acgtgtctgacaccgggacacgtctaatccaagcaatgtccgtgcttcat |
23290000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 92
Target Start/End: Complemental strand, 482248 - 482184
Alignment:
| Q |
28 |
tgtcggtgtcgaacacgtgtctgataccgcaacacgtctaatccaaggaatgtccgtgcttcatt |
92 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||||||||| | || ||||| ||||||||| |
|
|
| T |
482248 |
tgtcggtgtcggacacgtgtctgacacctgaacacgtctaatccgatgagtgtccatgcttcatt |
482184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 91
Target Start/End: Complemental strand, 18054769 - 18054718
Alignment:
| Q |
40 |
acacgtgtctgataccgcaacacgtctaatccaaggaatgtccgtgcttcat |
91 |
Q |
| |
|
|||||||||||| || | |||||| || |||||||||||||||||||||||| |
|
|
| T |
18054769 |
acacgtgtctgacacggaaacacgccttatccaaggaatgtccgtgcttcat |
18054718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 89
Target Start/End: Original strand, 11666021 - 11666070
Alignment:
| Q |
40 |
acacgtgtctgataccgcaacacgtctaatccaaggaatgtccgtgcttc |
89 |
Q |
| |
|
|||||||||||||| || |||||| ||||| |||||| |||||||||||| |
|
|
| T |
11666021 |
acacgtgtctgatatcggaacacgcctaattcaaggagtgtccgtgcttc |
11666070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 92
Target Start/End: Complemental strand, 25948880 - 25948847
Alignment:
| Q |
59 |
acacgtctaatccaaggaatgtccgtgcttcatt |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
25948880 |
acacgtgtaatccaaggaatgtccgtgcttcatt |
25948847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University