View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_25 (Length: 310)
Name: NF12545_high_25
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_25 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 6 - 310
Target Start/End: Complemental strand, 37644105 - 37643801
Alignment:
| Q |
6 |
agaagcagagagagttcgaacaattatcccctctttgaattgactcgttgagtaaatttttcccatctgtatccacaggaaactagaggcgcccttagta |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37644105 |
agaaccagagagagttcgaacaattatcccctctttgaattgactcgttgagtaaatttttcccatctgtatccacgggaaactagagccgcccttagta |
37644006 |
T |
 |
| Q |
106 |
aatgtgtaatcattatttatgtgccaataaaattctggctactttgactttgtgtgtagatggatggttcagtttcagcgtacacatcaaaaaacaaaga |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37644005 |
aatgtgtaatcattatttatgtgccaagaaaattctggctactttgactttgtgtgcagatggatggttcagtttcagtgtacacatcaaaaaacaaaga |
37643906 |
T |
 |
| Q |
206 |
atgtaacactgagattcatccctctgtaatttgatggttttccttagtttaacccaagcttcaaatttggcggacctcctgatttaccacattgagattc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643905 |
atgtaacactgagattcatccctctgtaatttgatggttttccttagtttaacccaagcttcaaatttggcggacctcctgatttaccacattgagattc |
37643806 |
T |
 |
| Q |
306 |
acagc |
310 |
Q |
| |
|
|||| |
|
|
| T |
37643805 |
gcagc |
37643801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University