View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_33 (Length: 260)
Name: NF12545_high_33
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 260
Target Start/End: Original strand, 26323488 - 26323745
Alignment:
| Q |
3 |
gagagagaagaaaatggttcaagaattttcaagacaagctgttggaatctagagataccccctaaacatacttagattgatttgagtttgagcattgatt |
102 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26323488 |
gagagtgaagaaaacggttcaagaattttcaagacaagctgttggaatctagagataccccctaaacatacttagattgatttgagtttgagcattggtt |
26323587 |
T |
|
| Q |
103 |
ttgttattgcactaccaaaataataaacggtttgatattattttggtggttgttgattaactataaaagtatgcttattgttttccacttaagcatgcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26323588 |
ttgttattgcactaccaaaataataaacggtttgatattattttggtggttgttgattaactatcaaagtatgcttattgttttccacttaagcatgcat |
26323687 |
T |
|
| Q |
203 |
agtcatagttctaacagtcacatttttgttcacaggggataattaaagttaatggctc |
260 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26323688 |
agtcatagttataacagtcacatttctgttcacaggggataattaaagttaatggctc |
26323745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University