View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_39 (Length: 241)
Name: NF12545_high_39
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 34964718 - 34964513
Alignment:
| Q |
16 |
tgaaacatacaaatttaatttcaattatca--gttagaaattaaagtagatctccttccatatctttatcataaagagtgttttatgtcacctttgatgg |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34964718 |
tgaaacatacaagtttaatttcaattatcacagttagaaattaaagtagatctccttccatatctttatcataaag----ttttatgtcacctttgatgg |
34964623 |
T |
 |
| Q |
114 |
tatgtgtgaaagaaacagcaactgcagcaaatgagacattgctggtcacatggcctaatgcatgacagacagctacaggaatcagcaacttcagctggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34964622 |
tatgtgtgaaagaaacagcaactgcagcaaatgagacattgctggtcacatggcctaatgcatgacagacagctacaggaatcagcaacttcagctggtt |
34964523 |
T |
 |
| Q |
214 |
gccgtctatt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
34964522 |
gccgtctatt |
34964513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University