View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_45 (Length: 237)
Name: NF12545_high_45
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 24 - 222
Target Start/End: Complemental strand, 26867021 - 26866828
Alignment:
| Q |
24 |
ggatattctatcataatcgaagttgttacttgttagctaacgcttcaaagcgaaaatgtatatataattaggacaaatcctgttgagccaacgtttttta |
123 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26867021 |
ggatattctatcaaaatcgaagttgttacttgttagctaacgcttc-----gaaaatgtatatataattaggacaaatcctgttgagccaacgtttttta |
26866927 |
T |
 |
| Q |
124 |
cttcaaccgtacagcccaatatatagtactatatccgttcctgattataagaccattttgagaannnnnnnngtccctttttataagacccctttgcta |
222 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||| | | ||||||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
26866926 |
cttcaactgtacaacccaatatatagtactacctccgtccttaattataagacccttttgagaattttttttgtctctttttataagacccctttgcta |
26866828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 187
Target Start/End: Complemental strand, 34948688 - 34948651
Alignment:
| Q |
150 |
tactatatccgttcctgattataagaccattttgagaa |
187 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
34948688 |
tactacatccgttcctaattataagaccattttgagaa |
34948651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University