View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_46 (Length: 234)
Name: NF12545_high_46
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_46 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 14460 - 14653
Alignment:
| Q |
19 |
aaggcgaagatgatgatactaaacttatgcctacttttaaagtgattgcttctgaagacattgacattgatgaaatggggcaaaaatctttgtttattat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14460 |
aaggcgaagatgatgatactaaacttatgcctacttttaaagtgattgcttctgaagacattgacattgatgaaatggggcaaaaatctttgtttattat |
14559 |
T |
 |
| Q |
119 |
attcttgacgaagataacacctaatagaagaatatggaacgtgctgcatatgggtggagactcaaagctgattaagaaaattttatgtcccagt |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14560 |
attcttgacgaatataacacctaatagaagaatatggaacgtgctgcatatgggtggagagtcaaagctgattaagaaaattttatgtcccagt |
14653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University