View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_high_52 (Length: 219)
Name: NF12545_high_52
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 21 - 200
Target Start/End: Original strand, 34109628 - 34109808
Alignment:
| Q |
21 |
gagatatgttgcatgtgatcttgaacataagcaacaaaataattatatttaattccttcnnnnnnnnnt-tatatttaatggtctaaacataagcatact |
119 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
34109628 |
gagatatgttccatgtgatctcgaacataagcaacaaaataattatatttaatttcttaaaaaaaataaatatatttaatggtctaaacataagcatacg |
34109727 |
T |
|
| Q |
120 |
ttaactacttctattatatttagtgttannnnnnnnctaaatttcttcgatattcttttattcttctgataacatgttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34109728 |
ttaactacttctattatatttagtgttattttttttctaaatttcttcgatattcttttattcttctgataacatgttctc |
34109808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University