View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12545_high_53 (Length: 209)

Name: NF12545_high_53
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12545_high_53
NF12545_high_53
[»] chr6 (1 HSPs)
chr6 (15-191)||(980870-981046)


Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 981046 - 980870
Alignment:
15 caaaggagggcgtacgaaatggtttgttctaatgtg-agaatcatattttggttgtatttttgcaaatttagtttcaggttacctaccatactataactt 113  Q
    ||||||||||| |||||||||||| |||| |||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||    
981046 caaaggagggcatacgaaatggtt-gttccaatgtgtaaaatcatattttggtagtatttttgcaaatttagtttcaggttacctatcatactctaactt 980948  T
114 tttctttgctttaacataatgtgataggagacagatttgagaagacccatttgtcgagctgaggttatagtgacaact 191  Q
    |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
980947 tttctttgctttaacataatatgataggagacagaattgagaagacccatttgtcgagctgaggttatagtgacaact 980870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University