View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_25 (Length: 330)
Name: NF12545_low_25
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 131 - 323
Target Start/End: Original strand, 49656922 - 49657114
Alignment:
| Q |
131 |
cacggacaaaaatcttatgaacctcttatattgaggttgacgatgtaagaaaatgatatcagttgtcaaagattaatattagtggtgccacctaccaatc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49656922 |
cacggacaaaaatcttatgaacctcttatattgaggttgacgatgtaagaaaatgacatcagttgtcaaagattaatattagtggtgccacctaccaatc |
49657021 |
T |
 |
| Q |
231 |
accctcttgcttctcttttgctgaattatcaccacaaatctgtgatcctaattaattcgcattatacttccatcattcagaccttcactctgt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49657022 |
accctcttgcttctcttttgctgaattatcaccacaaatctgtgatcctaattaattcgcattatactaccatcattcagaccttcactctgt |
49657114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 49656818 - 49656927
Alignment:
| Q |
1 |
tgttcatacaattagtttcctcaaactttttctaattgatgattgcgatgaataaaccagttgctggaagaaataaagtatagaaaagcaaaaaggtttg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49656818 |
tgttcatactcttagtttcctcaaactttttctaattgatgattgcgatgaataaaccagttgctggaagaaataaagtatagaaaagcaaaaaggtttg |
49656917 |
T |
 |
| Q |
101 |
cagccacgga |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
49656918 |
cagccacgga |
49656927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University