View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_30 (Length: 275)
Name: NF12545_low_30
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 38015101 - 38014849
Alignment:
| Q |
1 |
caatcatatcacccaccaataagccttggctttaatttgagagagagaaatgacactttggtctaagtggatatttgtttatactgcaaggtgtttatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||||||| ||||||||||||| |
|
|
| T |
38015101 |
caatcatatcacccaccaataagccttggctttaatttgagagagaaaaatgacactttggtccacgtggatatttgtttatactgtaaggtgtttatgc |
38015002 |
T |
 |
| Q |
101 |
aattgtgcatcttaccatatatgttataagaatttgttaacgactattatctgacctttcatgaaccttccatggatctagttttatagcacc------- |
193 |
Q |
| |
|
|||| |||||| | ||||| ||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38015001 |
aattctgcatc-tcccataaatgttataagaatttattaacggctattgtctgacctttcatgaaccttccatggaactagttttatagcacctaattgt |
38014903 |
T |
 |
| Q |
194 |
-----atattgtccatcctgatcccattctcttaaaagtgcataccctatgcat |
242 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38014902 |
ccttattactgtccatcctgatcccattctcttaaaagtggataccctatgcat |
38014849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 265
Target Start/End: Complemental strand, 38014777 - 38014726
Alignment:
| Q |
214 |
attctcttaaaagtgcataccctatgcatggacactttggttcagtgttcat |
265 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38014777 |
attctcttaaaagtgcataccctatggttagacactttggttcagtgttcat |
38014726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University