View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_36 (Length: 259)
Name: NF12545_low_36
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 23 - 255
Target Start/End: Original strand, 4759725 - 4759957
Alignment:
| Q |
23 |
aaccctgctctccggtgactaaccacctgcgacgccaccatagataccaaaaccggcaccactccaagttctgttatcaactttctaaccttaacatctt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759725 |
aaccctgctctccggtgactaaccacctgtgacgccaccatagataccaaaaccggcaccactccaagttctgttatcaactttctaaccttaacatctt |
4759824 |
T |
|
| Q |
123 |
ctttaactaaactttcaatctcttttgcagctatctccttctcttcccagcttccaaagtgaagcatcttcactgtcttttgcagcaaaatttcagtttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4759825 |
ctttaactaaactttcaatctcttttgcagctatctccttctcttcccagcttccaaagtgaagcatcttcactgtcttttgcagcaaaatttcagtttc |
4759924 |
T |
|
| Q |
223 |
ttccaccacctcctcctcctccctatgcttctc |
255 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
4759925 |
ttccaccacctcctcctcctccttatgcttctc |
4759957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 66 - 195
Target Start/End: Original strand, 26982154 - 26982283
Alignment:
| Q |
66 |
ataccaaaaccggcaccactccaagttctgttatcaactttctaaccttaacatcttctttaactaaactttcaatctcttttgcagctatctccttctc |
165 |
Q |
| |
|
||||||| || |||||||| | |||||| || ||||||||||| ||||||||||||| |||| | | | ||||| |||||||| ||| ||| ||||| |
|
|
| T |
26982154 |
ataccaatacaggcaccacccgaagttcagtcatcaactttctgaccttaacatcttgtttagccagcatctcaatatcttttgctgcttcctctttctc |
26982253 |
T |
|
| Q |
166 |
ttcccagcttccaaagtgaagcatcttcac |
195 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |
|
|
| T |
26982254 |
ttcccagctcccaaagtgaagcttcttcac |
26982283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 195
Target Start/End: Complemental strand, 26999187 - 26999135
Alignment:
| Q |
143 |
tcttttgcagctatctccttctcttcccagcttccaaagtgaagcatcttcac |
195 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
26999187 |
tcttttgctgcttcctctttctcttcccagctcccaaagtgaagcttcttcac |
26999135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University