View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_39 (Length: 249)
Name: NF12545_low_39
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 100 - 243
Target Start/End: Complemental strand, 20475229 - 20475086
Alignment:
| Q |
100 |
attcttctgagttacacggcatataccgtatataaacgcagttaaacttttttcaattctacacatgacagtcagatgactagagaagtttcttaatggg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20475229 |
attcttctgagttacacggcatataccgtatataaacgcagttaaacttttttcaattctacacatgacagtcggatgactagagaagtttcttaatggg |
20475130 |
T |
 |
| Q |
200 |
aatggagaatcagatgtattcgtaggacattactccctatgctt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20475129 |
aatggagaatcagatgtattcgtaggacattactccctatgctt |
20475086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20475357 - 20475260
Alignment:
| Q |
1 |
acagtcaatcattatatcgattggaagaaaaccaattaattatacatagagataaacttcatgtatttctaaaattggttcgatcataaagatatttc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20475357 |
acagtcaatcattatatcgattggaagaaaaccaattaattatacatagagataaacttcatgtatttctaaaattgtttcgatcataaagatatttc |
20475260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University