View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_49 (Length: 234)
Name: NF12545_low_49
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 40319983 - 40319780
Alignment:
| Q |
15 |
atgaaagtggtaccgtcaattaaaacatgaaaaaccaatcctaaatagtttcacacttgaggggtatggttatggtagacttagacatgtgtcaagctat |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40319983 |
atgaaagtggtaccgttaattaaaacatgaaaaaccaatcctaaatagtttcacacttgaggggtatggttatggtagacttagacatgtgtcaagctat |
40319884 |
T |
|
| Q |
115 |
gaatgttaattgatttacatataagtccgatagaatttggatggatgctgactggtaatagcttgtacgcacacactattaatagatgatctacagacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40319883 |
gaatgttaattgatttacatataagtccgatagaatttggatggatgctgactggtaatagcttgtacgcacacactattaatagatgatctacagacat |
40319784 |
T |
|
| Q |
215 |
tgtt |
218 |
Q |
| |
|
|||| |
|
|
| T |
40319783 |
tgtt |
40319780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University