View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_52 (Length: 229)
Name: NF12545_low_52
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_52 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 229
Target Start/End: Original strand, 37643512 - 37643738
Alignment:
| Q |
3 |
atattatattctgaagtaaaatgtttaccatactatgaatctagtattatagtttaaacacatacgtcagactacagattttatattctcttgaacattt |
102 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643512 |
atattatattctgaaataaaatgtttatcatactatgaatctagtattatagtttaaacccatacgtcagactacagattttatattctcttgaacattt |
37643611 |
T |
 |
| Q |
103 |
tattttctaaaatattgtcatggcttttgctcatcgagtttgagttgtcttgctggtgtttgatcattcatgtaggaacaacagcaaaaacaacttgatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643612 |
tattttctaaaatattgtcatggcttttgctcatcgagtttgagttgtcttgctggtgtttgatcattcatgtaggaacaacagcaaaaacaacttgatc |
37643711 |
T |
 |
| Q |
203 |
tcattcttgcaattgcaaaggcaggta |
229 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37643712 |
tcattcttgcaattgcaaaggcaggta |
37643738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 39440849 - 39440891
Alignment:
| Q |
167 |
cattcatgtaggaacaacagcaaaaacaacttgatctcattct |
209 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
39440849 |
cattcgtgcaggaacaacagcaaaaacaacttgatctgattct |
39440891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University