View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12545_low_56 (Length: 209)
Name: NF12545_low_56
Description: NF12545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12545_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 981046 - 980870
Alignment:
| Q |
15 |
caaaggagggcgtacgaaatggtttgttctaatgtg-agaatcatattttggttgtatttttgcaaatttagtttcaggttacctaccatactataactt |
113 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
981046 |
caaaggagggcatacgaaatggtt-gttccaatgtgtaaaatcatattttggtagtatttttgcaaatttagtttcaggttacctatcatactctaactt |
980948 |
T |
 |
| Q |
114 |
tttctttgctttaacataatgtgataggagacagatttgagaagacccatttgtcgagctgaggttatagtgacaact |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
980947 |
tttctttgctttaacataatatgataggagacagaattgagaagacccatttgtcgagctgaggttatagtgacaact |
980870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University