View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12546_low_17 (Length: 207)

Name: NF12546_low_17
Description: NF12546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12546_low_17
NF12546_low_17
[»] chr6 (1 HSPs)
chr6 (1-115)||(2919124-2919246)
[»] chr2 (1 HSPs)
chr2 (139-177)||(31412906-31412944)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 2919124 - 2919246
Alignment:
1 aatacaatatgtcctctttaacactggacatcaaaggcaacccttcaatgctctataacaaagttccagtta--------tgccagaaaatagaatataa 92  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         || ||||||||||||||||    
2919124 aataccatatgtcctctttaacactggacatcaaaggcaacccttcaatgctctataacaaagttccagttaattatgctagctagaaaatagaatataa 2919223  T
93 gtagtagaatatttttctcatca 115  Q
    |||||||||||||||||||||||    
2919224 gtagtagaatatttttctcatca 2919246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 139 - 177
Target Start/End: Original strand, 31412906 - 31412944
Alignment:
139 tcgtagaaacaaaatgaaaatgggtttggagatggagaa 177  Q
    |||||||| ||||||||||||||||||||||||||||||    
31412906 tcgtagaagcaaaatgaaaatgggtttggagatggagaa 31412944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University