View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12546_low_4 (Length: 412)
Name: NF12546_low_4
Description: NF12546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12546_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 365; Significance: 0; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 14 - 398
Target Start/End: Complemental strand, 41118297 - 41117913
Alignment:
| Q |
14 |
cagagagggcgggggatgtgcttacttactatgaatttgatttgttgtagggtctttacaagtcatcagggattttctgcactcaatgtggggctgaagg |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41118297 |
cagagggggcgggggatgtgcttacttactatgaatttgatttgttgtagggtctttacaagtcatctgggattttctgcactcaatgtggggctgaagg |
41118198 |
T |
 |
| Q |
114 |
cttccgtaaaattacattttatctggtttgcatcttagagaagttaatatgatgatcaaatcttaactttcttaaaatttatttccaacatcaaattaga |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41118197 |
cttccgtaaaattacattttatcaggtttgcatcttagagaagttaatatgatgatcaaatcttaactttcttaaaatttatttccaacatcaaatgaga |
41118098 |
T |
 |
| Q |
214 |
gtttttatactgattttccaggatgcaggtcccattgcccatcaggtgcggccacactcttatatccaggttagaatttggataccttttgctcaaaccc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41118097 |
gtttttatactgattttccaggatgcaggtcccattgcccatcaggtgcggccacactcttatatccaggttagaatttggatatcttttgctcaaaccc |
41117998 |
T |
 |
| Q |
314 |
atttgtctccaacccccacaccccacatatgccttataagtttgtatttatattttatttccttgtttgcatatgcgcaacttct |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41117997 |
atttgtctccaacccccacaccccacatatgccttataagtttgtatttatattttatttccttgtttgcatatgcgcaacttct |
41117913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 21 - 211
Target Start/End: Complemental strand, 41107822 - 41107635
Alignment:
| Q |
21 |
ggcgggggatgtgcttacttactatgaatttgatttgttgtagggtctttacaagtcatcagggattttctgcactcaatgtggggctgaaggcttccgt |
120 |
Q |
| |
|
||||||| ||||| |||||| ||| |||||||||| | ||||||||||||||||||||| |||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
41107822 |
ggcggggaatgtgtctacttaatataaatttgatttttcgtagggtctttacaagtcatctgggaatttctgtactcaatgtgaggctgaaggcttccgt |
41107723 |
T |
 |
| Q |
121 |
aaaattacattttatctggtttgcatcttagagaagttaatatgatgatcaaatcttaactttcttaaaatttatttccaacatcaaatta |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||| | || |||| ||||||||| |||||| ||||||||||| |
|
|
| T |
41107722 |
aaaattacattttatcaggtttgcatcttagaggagttaatatgatgatcaga--tttacttccttaaaattaatttcc-acatcaaatta |
41107635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 222 - 325
Target Start/End: Complemental strand, 41105906 - 41105803
Alignment:
| Q |
222 |
actgattttccaggatgcaggtcccattgcccatcaggtgcggccacactcttatatccaggttagaatttggataccttttgctcaaacccatttgtct |
321 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| ||||||||||||||||| || ||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
41105906 |
actgattttccaggatggaggtcccatggcccatccagtgcggccacactcttacattaaggttagaatttggataccttttcctcaaatccatttgtct |
41105807 |
T |
 |
| Q |
322 |
ccaa |
325 |
Q |
| |
|
|||| |
|
|
| T |
41105806 |
ccaa |
41105803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University